View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1383_low_21 (Length: 286)

Name: NF1383_low_21
Description: NF1383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1383_low_21
NF1383_low_21
[»] chr7 (1 HSPs)
chr7 (46-223)||(5970703-5970879)


Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 46 - 223
Target Start/End: Original strand, 5970703 - 5970879
Alignment:
Q  46 aacaatattcaacactcacacacaaagggagaatacaaaaaagagtttcaagtctttttctttttggtataatattcaaagatgaggagtagtagtgatt 145  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  5970703 aacaatattcaacactcacacacaaaaggagaatacaaaaaagagtttgaagtctttt-ctttttggtataatattcaaagatgaggagtagtagtgatt 5970801  T
Q  146 caaatatgagaggttcaaagaagaaggtgtcatccaaaaagctaggagggtatctcaaagagcaaaaaggaagattat 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||    
T  5970802 caaatatgagaggttcaaagaagaaggtgtcatccaaaaagctaggaggctatctcaaagagcaaaagggaagattat 5970879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University