View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13836_low_35 (Length: 225)

Name: NF13836_low_35
Description: NF13836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13836_low_35
NF13836_low_35
[»] chr2 (1 HSPs)
chr2 (2-208)||(43457970-43458176)
[»] chr8 (1 HSPs)
chr8 (158-208)||(4500936-4500986)


Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 2 - 208
Target Start/End: Complemental strand, 43458176 - 43457970
Alignment:
Q  2 ttgaaccagggttgttcttctatcttttttgcttgatgtgaaatggtgctaatgaagcttatctttacatgattcatttcagaagaagtagcaatgcaga 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43458176 ttgaaccagggttgttcttctatcttttttgcttgatgtgaaatggtgctaatgaagcttatctttacatgattcatttcagaagaagtagcaatgcaga 43458077  T
Q  102 gaatgggtagtagagataatccaacacttgagtcagccactggagttgctccaaagagaggaatggttcttccttttcaaccacttgcaatgtcttttga 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43458076 gaatgggtagtagagataatccaacacttgagtcagccactggagttgctccaaagagaggaatggttcttccttttcaaccacttgcaatgtcttttga 43457977  T
Q  202 tagtgtt 208  Q
    |||||||    
T  43457976 tagtgtt 43457970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 4500936 - 4500986
Alignment:
Q  158 agaggaatggttcttccttttcaaccacttgcaatgtcttttgatagtgtt 208  Q
    ||||||||| |||| ||||| ||||||||||||||||| ||||| ||||||    
T  4500936 agaggaatgattctacctttccaaccacttgcaatgtcctttgagagtgtt 4500986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University