View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13836_low_33 (Length: 239)

Name: NF13836_low_33
Description: NF13836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13836_low_33
NF13836_low_33
[»] chr6 (1 HSPs)
chr6 (1-222)||(18236818-18237039)


Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 18237039 - 18236818
Alignment:
Q  1 taatttggcatactatcatttgggttggtttggaatataataaaggagaaagttttcgaacatatgtcaaaagaggtggttaacatggttgataagatca 100  Q
    ||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  18237039 taatttggcatacgatcatttgggttggtttggaatacaataaaggagaaagttttcgaacataggtcaaaagaggtggttaacatggttgataagatca 18236940  T
Q  101 acgagttgtcttggatatggcgtttatgtagattgatagtttccgcatgtctcttttacgagtgagatttgggagaatgcttcatgaggtagagattatt 200  Q
    ||||| |||||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||    
T  18236939 acgagctgtcttggatatggcgtttaagtagattgatggtttccgcatgtctcttctacgagtgagattcgggagaatgcttcatgaggtagagattatt 18236840  T
Q  201 tggtcgagtggagtgcctattt 222  Q
    ||||||||||||||||||||||    
T  18236839 tggtcgagtggagtgcctattt 18236818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University