View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13836_low_24 (Length: 284)

Name: NF13836_low_24
Description: NF13836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13836_low_24
NF13836_low_24
[»] chr7 (3 HSPs)
chr7 (159-277)||(33305628-33305746)
chr7 (17-124)||(33305749-33305856)
chr7 (148-221)||(31540632-31540705)


Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 159 - 277
Target Start/End: Complemental strand, 33305746 - 33305628
Alignment:
Q  159 ttacattcacattttcaccattgtctttgctgaacttatttgattttttggaaccattcttcagtaagattggatttgtcacaaattgttggaagacaca 258  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33305746 ttacattcacattttcaccgttgtctttgctgaacttatttgattttttggaaccattcttcagtaagattggatttgtcacaaattgttggaagacaca 33305647  T
Q  259 tatgaaatttgtgatgatg 277  Q
    |||||||||||| ||||||    
T  33305646 tatgaaatttgtaatgatg 33305628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 17 - 124
Target Start/End: Complemental strand, 33305856 - 33305749
Alignment:
Q  17 atgttcaaactcagatnnnnnnngtaatatctttaaattcatcagtagcaagaagttcacctactagaaacatatgaaaatgctttgaatttcaagcaaa 116  Q
    ||||||||||||||||       |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  33305856 atgttcaaactcagataaaaaaagtaatatcttcaaattcattagtagcaagaagttcacctactagaaacatatgaaaatgcattgaatttcaagcaaa 33305757  T
Q  117 atatgcaa 124  Q
    ||||||||    
T  33305756 atatgcaa 33305749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 148 - 221
Target Start/End: Original strand, 31540632 - 31540705
Alignment:
Q  148 atataattacattacattcacattttcaccattgtctttgctgaacttatttgattttttggaaccattcttca 221  Q
    ||||| |||||||||| ||||||||||||  ||||||||||||||||||| || |||| |||||||||||||||    
T  31540632 atatagttacattacaatcacattttcacttttgtctttgctgaacttatctggttttatggaaccattcttca 31540705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University