View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13835_high_25 (Length: 267)

Name: NF13835_high_25
Description: NF13835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13835_high_25
NF13835_high_25
[»] chr5 (1 HSPs)
chr5 (23-252)||(38792130-38792358)
[»] chr2 (1 HSPs)
chr2 (171-205)||(5838358-5838392)
[»] chr1 (2 HSPs)
chr1 (67-104)||(52474429-52474466)
chr1 (170-206)||(4519890-4519926)


Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 23 - 252
Target Start/End: Complemental strand, 38792358 - 38792130
Alignment:
Q  23 aagttttaattaagcattacttcttgaaaatatgaattgtgtcaatgaagaatatggcaagtgctgtaatatgcaatactttgnnnnnnnntattactat 122  Q
    ||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||     
T  38792358 aagttttaattaagcattacttcttgaaaatgttaattgtgtcaatgaagaatatggcaagtgctgtaatatgcaatactttgaaaaaaa-tattactac 38792260  T
Q  123 tgccttgaacttgtgtttatccctttttgaggtttaaaattgaactgttttaagagttatttttggtttcagaattttgaggacnnnnnnnnggggtatt 222  Q
    |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||        || | |||    
T  38792259 tgccttaaacctgtgtttatccctttttgaggtttaaaattgaactgttttaagagttatttttggtttcagaatttcgaggactttgttgtggagcatt 38792160  T
Q  223 tcgtcagtcgtgctcatgatattatggttg 252  Q
    ||||||| ||||||||||||||||||||||    
T  38792159 tcgtcagccgtgctcatgatattatggttg 38792130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 205
Target Start/End: Complemental strand, 5838392 - 5838358
Alignment:
Q  171 tttaagagttatttttggtttcagaattttgagga 205  Q
    |||||| ||||||||||||||||||||||||||||    
T  5838392 tttaagtgttatttttggtttcagaattttgagga 5838358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 67 - 104
Target Start/End: Original strand, 52474429 - 52474466
Alignment:
Q  67 atgaagaatatggcaagtgctgtaatatgcaatacttt 104  Q
    ||||||| ||||| ||||||||||||||||||||||||    
T  52474429 atgaagattatggaaagtgctgtaatatgcaatacttt 52474466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 206
Target Start/End: Complemental strand, 4519926 - 4519890
Alignment:
Q  170 ttttaagagttatttttggtttcagaattttgaggac 206  Q
    ||||||| |||||||||||||| ||||||||||||||    
T  4519926 ttttaagtgttatttttggttttagaattttgaggac 4519890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University