View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1382_low_13 (Length: 323)

Name: NF1382_low_13
Description: NF1382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1382_low_13
NF1382_low_13
[»] chr8 (1 HSPs)
chr8 (8-108)||(36645837-36645937)
[»] chr3 (1 HSPs)
chr3 (280-323)||(34541678-34541721)


Alignment Details
Target: chr8 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 8 - 108
Target Start/End: Original strand, 36645837 - 36645937
Alignment:
Q  8 atccattaagttccacattggctagaatatggaacaagtgtgtgtttataaaggtctggcatgctggtatgttctccgagctgggtaatactagcttgtg 107  Q
    ||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||  |||||||| |||| || ||||||||    
T  36645837 atccattaagtcccacattggctagaatatggaacaagtatgtgtttataaaggtctggcatgctagtatgtttgccgagctgcgtaacaccagcttgtg 36645936  T
Q  108 a 108  Q
    |    
T  36645937 a 36645937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 280 - 323
Target Start/End: Original strand, 34541678 - 34541721
Alignment:
Q  280 aaacctcgactataataagcaaaatgaaaagaaaattagttgaa 323  Q
    ||||||||||||||||||||||||||||| ||||||||||||||    
T  34541678 aaacctcgactataataagcaaaatgaaacgaaaattagttgaa 34541721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University