View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13819_high_5 (Length: 218)

Name: NF13819_high_5
Description: NF13819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13819_high_5
NF13819_high_5
[»] chr6 (2 HSPs)
chr6 (18-207)||(15953421-15953610)
chr6 (21-54)||(16399236-16399269)


Alignment Details
Target: chr6 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 15953610 - 15953421
Alignment:
Q  18 gtataatggtcgtttttgcaatgacaatgttacaataatatgaaacaataatactatatgttattattcnnnnnnncaaatactatatgttattgttcat 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||    
T  15953610 gtataatggtcgtttttgcaatgacaatgttacaataatatgaaacaataatactatatgttattattcaaaaaaacaaatactatatgttattgttcat 15953511  T
Q  118 attataattttataataaaactttagtttgataatccataatttaattatatgaaacttactatttaaatcaaacaatatagagtataat 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15953510 attataattttataataaaactttagtttgataatccataatttaattatatgaaacttactatttaaatcaaacaatatagagtataat 15953421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 54
Target Start/End: Original strand, 16399236 - 16399269
Alignment:
Q  21 taatggtcgtttttgcaatgacaatgttacaata 54  Q
    ||||| ||||||||||||||||||||||||||||    
T  16399236 taatgatcgtttttgcaatgacaatgttacaata 16399269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University