View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13797_high_14 (Length: 293)

Name: NF13797_high_14
Description: NF13797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13797_high_14
NF13797_high_14
[»] chr1 (2 HSPs)
chr1 (137-278)||(38087403-38087546)
chr1 (1-104)||(38087579-38087680)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 137 - 278
Target Start/End: Complemental strand, 38087546 - 38087403
Alignment:
Q  137 aaacacatcttgtacgtagtgaggatgatttttaatatattttacttttgagttcttnnnnnnnn--ttatggataaggctccttagtacgaacactgaa 234  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||          |||||||||| |||||||| |||||||||||||    
T  38087546 aaacacatcttgtacgtaatgaggatgatttttaatatattttacttttgagttcttaaaaaaaaaattatggataatgctccttattacgaacactgaa 38087447  T
Q  235 aaatgaaacacatgaaatgatattgtcagttgaatttctcaatc 278  Q
    ||||||||||||||||||||||| | ||||||||||||||||||    
T  38087446 aaatgaaacacatgaaatgatatgggcagttgaatttctcaatc 38087403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 38087680 - 38087579
Alignment:
Q  1 ctaaaggcaaataaaccggattttacttttgatattcacttttggtgtgcatagggtacaccaaaactttgtaattgtggttcttacttctgtcatctat 100  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |    
T  38087680 ctaaaggcaaataa-ccggattttacttttgatattcacttttggtgtgcatagg-tacaccaaaactttgtaattgtggttcttacttctgtcatcttt 38087583  T
Q  101 aata 104  Q
    ||||    
T  38087582 aata 38087579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University