View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13789_low_36 (Length: 259)

Name: NF13789_low_36
Description: NF13789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13789_low_36
NF13789_low_36
[»] chr3 (1 HSPs)
chr3 (144-242)||(40889500-40889598)
[»] scaffold0221 (1 HSPs)
scaffold0221 (42-84)||(25160-25202)
[»] chr7 (1 HSPs)
chr7 (107-143)||(11593117-11593153)


Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 144 - 242
Target Start/End: Complemental strand, 40889598 - 40889500
Alignment:
Q  144 agtggtaaactagtcttacctattctactaacgcaacacctgagaccaatagcatagttatatgatttacttttatttgaaaagtagaaaggggttagt 242  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40889598 agtggtaaactagtcttacctattctactaacgcaacacctgataccaatagcatagttatatgatttacttttatttgaaaagtagaaaggggttagt 40889500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0221 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0221
Description:

Target: scaffold0221; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 84
Target Start/End: Complemental strand, 25202 - 25160
Alignment:
Q  42 tcgacgtggttctctcaagcgccctagtatactctacttgttc 84  Q
    ||||| |||||||||||||||||||||||||||||||||||||    
T  25202 tcgacatggttctctcaagcgccctagtatactctacttgttc 25160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 143
Target Start/End: Complemental strand, 11593153 - 11593117
Alignment:
Q  107 gtcagttcaccgggaggatcgccctcccaattcgaag 143  Q
    |||||||||  ||||||||||||||||||||||||||    
T  11593153 gtcagttcattgggaggatcgccctcccaattcgaag 11593117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University