View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13785_low_6 (Length: 235)

Name: NF13785_low_6
Description: NF13785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13785_low_6
NF13785_low_6
[»] chr1 (1 HSPs)
chr1 (1-221)||(42732971-42733191)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 42732971 - 42733191
Alignment:
Q  1 attcaaattcaatttacagcactaacagtcaaacacacaaatgggtgtgtttcatccgcaacacagtaagtatcaggacataaattgtcaaacacacatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||    
T  42732971 attcaaattcaatttacagcactaacagtcaaacacacaaatgggtgtgtttcatctgcaacacagtaagtatcatgatataaattgtcaaacacacatt 42733070  T
Q  101 tgatgaagacaaaatttttaatttttatcatatctattgctttcaagttgtctnnnnnnnntataactttgaagctagaatttgaaatttttgactttta 200  Q
    |||||||||||||| ||||||||||| |||| |||||||| ||||||||||||        ||||||||||||| |||||||||||||||||||||||||    
T  42733071 tgatgaagacaaaaattttaatttttgtcatgtctattgccttcaagttgtctaaaaaaaatataactttgaaggtagaatttgaaatttttgactttta 42733170  T
Q  201 aacagatttttagtggcaaat 221  Q
    |||||||||||||| ||||||    
T  42733171 aacagatttttagttgcaaat 42733191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University