View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13777_low_98 (Length: 239)

Name: NF13777_low_98
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13777_low_98
NF13777_low_98
[»] chr4 (1 HSPs)
chr4 (24-223)||(35772401-35772601)
[»] chr2 (1 HSPs)
chr2 (27-148)||(33761848-33761969)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 24 - 223
Target Start/End: Original strand, 35772401 - 35772601
Alignment:
Q  24 ggtttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagcagagattg 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35772401 ggtttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagcagagattg 35772500  T
Q  124 atctctacaaattcgacccatgggaactcccaagtatcaaactttttcacaccccatttcatcttttcatccatttactc-aaacccacatcctagattt 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  35772501 atctctacaaattcgacccatgggaactcccaagtatcaaactttttcacaccccatttcatcttttcatccatttactcaaaacccacatcctagattt 35772600  T
Q  223 t 223  Q
    |    
T  35772601 t 35772601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 27 - 148
Target Start/End: Original strand, 33761848 - 33761969
Alignment:
Q  27 ttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagcagagattgatc 126  Q
    |||||||| |||||||| |||||||| || |||||||| |||||||| | |||||| ||||| || ||| | ||||||||||||||||| ||  ||||||    
T  33761848 ttccgatttcaccctacagatgaagagcttgttgttcattacctcaagaaaaaagcagcttcagctcctttaccagtagccatcatagctgaagttgatc 33761947  T
Q  127 tctacaaattcgacccatggga 148  Q
    |||||||||| || ||||||||    
T  33761948 tctacaaatttgatccatggga 33761969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University