View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13766_low_15 (Length: 225)

Name: NF13766_low_15
Description: NF13766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13766_low_15
NF13766_low_15
[»] chr2 (1 HSPs)
chr2 (1-36)||(41759446-41759481)


Alignment Details
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 41759481 - 41759446
Alignment:
Q  1 acccttaatataatatagcgaatgttttgtagtatg 36  Q
    ||||||||||||||||||||||||||||||||||||    
T  41759481 acccttaatataatatagcgaatgttttgtagtatg 41759446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University