View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1375R-Insertion-5 (Length: 181)

Name: NF1375R-Insertion-5
Description: NF1375R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1375R-Insertion-5
NF1375R-Insertion-5
[»] chr1 (1 HSPs)
chr1 (8-181)||(26203151-26203324)


Alignment Details
Target: chr1 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 8 - 181
Target Start/End: Complemental strand, 26203324 - 26203151
Alignment:
Q  8 actaaacaggcaaagaattgacaagctatgaaaaaccaaagcctaatataggaatccacagatatgtgtttgtcctattcaagcnnnnnnngatgaagaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |  ||||||    
T  26203324 actaaacaggcaaagaattgacaagctatgaaaaaccaaagcctaatataggaatccacagatatgtgtttgtcctattcaagcaagaaaaggggaagaa 26203225  T
Q  108 gcactcaattgttgcacctttttcaagggatcactttaacacacgtgccttttctgctcaaaatgaccttggtg 181  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26203224 gcactcaattgttgctcctttttcaagggatcactttaacacacgtgccttttctgctcaaaatgaccttggtg 26203151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University