View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13754_low_7 (Length: 216)

Name: NF13754_low_7
Description: NF13754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13754_low_7
NF13754_low_7
[»] chr8 (1 HSPs)
chr8 (13-195)||(14752373-14752555)


Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 195
Target Start/End: Original strand, 14752373 - 14752555
Alignment:
Q  13 ctttcttcatcatttcctccagtgtgtttgatgatgtcgagttcccatcggcttccataagaataattggaagagttggagatgctgcattgattttgga 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  14752373 ctttcttcatcatttcctccagtgtgtttgatgatgtcgagttcccatcggcttccataagaataattggaagagttggcgatgctgcattgattttgga 14752472  T
Q  113 aatgaggggcgaggttgtaaaggcgaggacaggtttggaatccgcgatctgcttcgcgatttcatgtactgtgttgaggggat 195  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14752473 aacgaggggcgaggttgtaaaggcgaggacaggtttggaatccgcgatctgcttcgcgatttcatgtactgtgttgaggggat 14752555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University