View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13751_high_20 (Length: 210)

Name: NF13751_high_20
Description: NF13751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13751_high_20
NF13751_high_20
[»] chr1 (2 HSPs)
chr1 (152-194)||(16861859-16861901)
chr1 (73-146)||(7284868-7284944)


Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 152 - 194
Target Start/End: Original strand, 16861859 - 16861901
Alignment:
Q  152 agcattgatacaagagtttcctatgaacctcaatgactatatt 194  Q
    |||||||||| ||||||||||||||||||||||||||||||||    
T  16861859 agcattgatagaagagtttcctatgaacctcaatgactatatt 16861901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 73 - 146
Target Start/End: Complemental strand, 7284944 - 7284868
Alignment:
Q  73 ccttaattattccttatttagcacgtcatatttttgcataagctca---gttatgtaaaattgacaggctaaacctc 146  Q
    |||||||||||| ||||||||||| ||| ||||  ||||| |||||   ||||||||| |||| |||||||||||||    
T  7284944 ccttaattattctttatttagcacttcaaatttccgcataggctcattggttatgtaacattggcaggctaaacctc 7284868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University