View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13749_high_3 (Length: 258)

Name: NF13749_high_3
Description: NF13749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13749_high_3
NF13749_high_3
[»] chr7 (2 HSPs)
chr7 (101-207)||(34926824-34926930)
chr7 (1-64)||(34926723-34926786)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 101 - 207
Target Start/End: Original strand, 34926824 - 34926930
Alignment:
Q  101 ttcaaacttctattttagaaatcctagaagcaaaagctcaagaaaaggtttactaagaagtaagaactaggttagaatagataatcaaaattctactagg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34926824 ttcaaacttctattttagaaatcctagaagcaaaagctcaagaaaaggtttactaagaagtaagaactaggttagaatagataatcaaaattctactagg 34926923  T
Q  201 aaaattt 207  Q
    |||||||    
T  34926924 aaaattt 34926930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 34926723 - 34926786
Alignment:
Q  1 cataaaatcgaaaaataccctgaatcaagaacattcaattaaaatcttaaatattttggagctt 64  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||    
T  34926723 cataaaatcgaaaaataccctgaatcaagaacattcaattaaaatctaaaatattttggggctt 34926786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University