View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1373_high_27 (Length: 253)

Name: NF1373_high_27
Description: NF1373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1373_high_27
NF1373_high_27
[»] chr2 (1 HSPs)
chr2 (42-243)||(40183459-40183663)


Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 42 - 243
Target Start/End: Original strand, 40183459 - 40183663
Alignment:
Q  42 ccgtcgacaacaatggtcatggctattagagaatcatatctatgccnnnnnnnn---actaaagaatcatatgtatgacatagatgatcaaattttctca 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||| |||||| ||||||||||||||    
T  40183459 ccgtcgacaacaatggtcatggctattagagaatcatatctatgcctttttttttttactaaagaatcatatgtatgatatagataatcaaattttctca 40183558  T
Q  139 ttgtacgaattgtgatttgagtttaagtatgaaattcttctattagtaggtcatacgtaaatttttgtcgtaaaccctcaccgtgattgattttttctct 238  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40183559 ttgtacgaattgtgatttgagtttgagtatgaaattcttctattagtaggtcatacgtaaatttttgtcgtaaaccctcaccgtgattgattttttctct 40183658  T
Q  239 ctctg 243  Q
    |||||    
T  40183659 ctctg 40183663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University