View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1372_low_28 (Length: 297)

Name: NF1372_low_28
Description: NF1372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1372_low_28
NF1372_low_28
[»] chr8 (1 HSPs)
chr8 (66-245)||(24505669-24505847)


Alignment Details
Target: chr8 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 66 - 245
Target Start/End: Complemental strand, 24505847 - 24505669
Alignment:
Q  66 agattttaggttctttatttattcccctggtcagggccaccattgagaaaattcccctgataaacactaataaggaggataccctcatgtggatgcatga 165  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24505847 agattttaggttctttatttattcccctggacagggccaccattgagaaaattcccctgataaacactaataaggaggataccctcatgtggatgcatga 24505748  T
Q  166 accgaacggaaactatacgggttaaaagtggttacaaggctatccaaatttggaaaactcaagctatcaacactctctct 245  Q
    |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||    
T  24505747 accgaacggaaactatac-ggttaaaagtggttacaaggctatccaagtttggaaaactcaagctatcaacactccctct 24505669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University