View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13725_low_9 (Length: 362)

Name: NF13725_low_9
Description: NF13725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13725_low_9
NF13725_low_9
[»] chr6 (3 HSPs)
chr6 (11-356)||(17075410-17075755)
chr6 (1-229)||(11053474-11053702)
chr6 (225-355)||(11064036-11064166)
[»] chr8 (3 HSPs)
chr8 (94-337)||(17683923-17684166)
chr8 (177-340)||(36159902-36160065)
chr8 (1-62)||(17684198-17684259)
[»] chr4 (2 HSPs)
chr4 (90-353)||(10559739-10560002)
chr4 (1-67)||(10558424-10558490)
[»] chr1 (1 HSPs)
chr1 (12-355)||(26741535-26741878)


Alignment Details
Target: chr6 (Bit Score: 162; Significance: 2e-86; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 11 - 356
Target Start/End: Original strand, 17075410 - 17075755
Alignment:
Q  11 cgctggtgttatttcttcgacaagaaagaaggttaagaaagtggtgcggccttttgctaaatccagttcaatagttataaagaggaagaaagtgaatgga 110  Q
    ||||||||||||||||||| |||| ||||||||||||||||||||||||||  ||||  |||||||| | || ||||  ||| ||||||||||||| |||    
T  17075410 cgctggtgttatttcttcggcaaggaagaaggttaagaaagtggtgcggcccattgcacaatccagtaccatcgttaacaagcggaagaaagtgaacgga 17075509  T
Q  111 attttgcggcattcggtatttagtttgaagaaggtggcgcggttgcccagcaaagaccgggccgccgttttgcacattttaaaatctaaatcgagaaaat 210  Q
    |||||||| || |||||  ||||| |||| |||||||||||| |||| |||||||| ||  || | ||||| ||||| ||||||||||||| ||||||||    
T  17075510 attttgcgacactcggtgattagtctgaaaaaggtggcgcggctgcctagcaaagatcgttcctcagttttacacatcttaaaatctaaattgagaaaat 17075609  T
Q  211 tacaaggttcggatcgtcttaaaaaggcggttagggcggtttcttcgagagtttcagatgggagttcctcgtcggggtcggttaacaatgattgggttaa 310  Q
    ||||||| ||||| || |||||||||||||| |  | |||||||||| ||| ||| ||||| ||||| || |||||||| ||||||||||||||||||||    
T  17075610 tacaaggctcggaacgccttaaaaaggcggtaaaagtggtttcttcgggagcttcggatggtagttcgtcatcggggtccgttaacaatgattgggttaa 17075709  T
Q  311 ttgggtggcagtgcatgggaatgagaaggttgtaattgatgatgtc 356  Q
    |||||||||||||||||| ||||||||||||||  |||||||||||    
T  17075710 ttgggtggcagtgcatggaaatgagaaggttgtgtttgatgatgtc 17075755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 11053474 - 11053702
Alignment:
Q  1 atcatggagtcgctggtgttatttcttcgacaagaaagaaggttaagaaagtggtgcggccttttgctaaatccagt-tcaatagttataaagaggaaga 99  Q
    ||||||| | ||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||  ||||| || ||  | |  |  ||  ||||||    
T  11053474 atcatggtgacgctggtgttatttcatcggcaagaaagaaggttaagaaagtggtgcggcctattgcccaatccggtatctgt-gcaaacaatcggaaga 11053572  T
Q  100 aagtgaatggaattttgcggcattcggtatttagtttgaagaaggtggcgcggttgcccagcaaagaccgggccgccgttttgcacattttaaaatctaa 199  Q
    ||||||||||  || ||||||| |||||  |||||||||| ||||||||||||||||| |||||||| ||| || || |||| || || |||||||||||    
T  11053573 aagtgaatggggttctgcggcactcggtgattagtttgaaaaaggtggcgcggttgcctagcaaagatcggtccaccattttacatatcttaaaatctaa 11053672  T
Q  200 atcgagaaaattacaaggttcggatcgtct 229  Q
    |||||| |||||||||||||| || |||||    
T  11053673 atcgaggaaattacaaggttcagaccgtct 11053702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 225 - 355
Target Start/End: Original strand, 11064036 - 11064166
Alignment:
Q  225 cgtcttaaaaaggcggttagggcggtttcttcgagagtttcagatgggagttcctcgtcggggtcggttaacaatgattgggttaattgggtggcagtgc 324  Q
    ||||||||||||| ||||| || |||||| |||  |||||| || || |||||||||||||| |||||||| ||||||||||| ||||||||||||||||    
T  11064036 cgtcttaaaaaggtggttaaggtggtttcctcggaagtttcggaaggtagttcctcgtcgggatcggttaataatgattgggtcaattgggtggcagtgc 11064135  T
Q  325 atgggaatgagaaggttgtaattgatgatgt 355  Q
    ||| ||||||||| || ||  ||||||||||    
T  11064136 atgagaatgagaaagtagtggttgatgatgt 11064166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 132; Significance: 2e-68; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 94 - 337
Target Start/End: Complemental strand, 17684166 - 17683923
Alignment:
Q  94 ggaagaaagtgaatggaattttgcggcattcggtatttagtttgaagaaggtggcgcggttgcccagcaaagaccgggccgccgttttgcacattttaaa 193  Q
    ||||||||||||||||  |||||||||| |||||  |||||||||| |||||||||| |||||| |||||||| ||| || ||||||| || || |||||    
T  17684166 ggaagaaagtgaatggggttttgcggcactcggtgattagtttgaaaaaggtggcgcagttgcctagcaaagatcggtccaccgttttacatatcttaaa 17684067  T
Q  194 atctaaatcgagaaaattacaaggttcggatcgtcttaaaaaggcggttagggcggtttcttcgagagtttcagatgggagttcctcgtcggggtcggtt 293  Q
    |||||||||||| |||||||||||||| || ||||||||||||| ||| | || |||||| ||| ||||||| || || |||||||||||| ||||||||    
T  17684066 atctaaatcgaggaaattacaaggttcagaccgtcttaaaaaggtggtaaaggtggtttcctcgggagtttcggaaggtagttcctcgtcgaggtcggtt 17683967  T
Q  294 aacaatgattgggttaattgggtggcagtgcatgggaatgagaa 337  Q
    || |||||||||||||||||||||||||||||||||||||||||    
T  17683966 aataatgattgggttaattgggtggcagtgcatgggaatgagaa 17683923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 177 - 340
Target Start/End: Complemental strand, 36160065 - 36159902
Alignment:
Q  177 gttttgcacattttaaaatctaaatcgagaaaattacaaggttcggatcgtcttaaaaaggcggttagggcggtttcttcgagagtttcagatgggagtt 276  Q
    |||||||||||| ||||||||||| | ||||||||||| || ||||||||||| ||||||||||| | || ||  |||||| ||| |||||||   ||||    
T  36160065 gttttgcacattctaaaatctaaagctagaaaattacatgggtcggatcgtctgaaaaaggcggtgaaggtggggtcttcgggagcttcagataaaagtt 36159966  T
Q  277 cctcgtcggggtcggttaacaatgattgggttaattgggtggcagtgcatgggaatgagaaggt 340  Q
    | || ||  | || |||||||| |||||||||||||  ||||  ||||||||||||||||||||    
T  36159965 cttcttcatgttcagttaacaacgattgggttaattttgtggttgtgcatgggaatgagaaggt 36159902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 17684259 - 17684198
Alignment:
Q  1 atcatggagtcgctggtgttatttcttcgacaagaaagaaggttaagaaagtggtgcggcct 62  Q
    ||||||| | ||||||||||||||| ||| ||||||||||||| | ||||||||||||||||    
T  17684259 atcatggtgacgctggtgttatttcatcggcaagaaagaaggtcaggaaagtggtgcggcct 17684198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 90 - 353
Target Start/End: Original strand, 10559739 - 10560002
Alignment:
Q  90 aagaggaagaaagtgaatggaattttgcggcattcggtatttagtttgaagaaggtggcgcggttgcccagcaaagaccgggccgccgttttgcacattt 189  Q
    ||||||||||||||||||||  || ||||||| |||||  |||||||||| ||||||| || | |||| |||||||| |   || ||||||| ||||| |    
T  10559739 aagaggaagaaagtgaatgggtttctgcggcactcggtgattagtttgaaaaaggtggggcagctgcctagcaaagatcaatccaccgttttacacatct 10559838  T
Q  190 taaaatctaaatcgagaaaattacaaggttcggatcgtcttaaaaaggcggttagggcggtttcttcgagagtttcagatgggagttcctcgtcggggtc 289  Q
    |||||||||||||||||||||||||||| || |||||||| ||||||||||| | || |||||||||| ||| ||||||||| ||||| || ||||| ||    
T  10559839 taaaatctaaatcgagaaaattacaaggatcagatcgtctcaaaaaggcggtaaaggtggtttcttcgggagcttcagatggtagttcttcctcgggttc 10559938  T
Q  290 ggttaacaatgattgggttaattgggtggcagtgcatgggaatgagaaggttgtaattgatgat 353  Q
     | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  10559939 agataacaatgattgggttaattgggtggcagtgcatgggaatgagaaggttgtagttgatgat 10560002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 10558424 - 10558490
Alignment:
Q  1 atcatggagtcgctggtgttatttcttcgacaagaaagaaggttaagaaagtggtgcggccttttgc 67  Q
    ||||||| | ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
T  10558424 atcatggtgacgctggtgttatttcttcggcaagaaagaaggttaagaaagtggtgcggcctattgc 10558490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 12 - 355
Target Start/End: Complemental strand, 26741878 - 26741535
Alignment:
Q  12 gctggtgttatttcttcgacaagaaagaaggttaagaaagtggtgcggccttttgctaaatccagttcaatagttataaagaggaagaaagtgaatggaa 111  Q
    |||||||||||||| ||| | || ||||||||||||| ||||| || |||| ||||| ||||  || |  | ||||  ||| |||||||||||||||  |    
T  26741878 gctggtgttatttcatcggctaggaagaaggttaagagagtggcgcagcctattgctcaatcatgtacctttgttaacaagcggaagaaagtgaatgaga 26741779  T
Q  112 ttttgcggcattcggtatttagtttgaagaaggtggcgcggttgcccagcaaagaccgggccgccgttttgcacattttaaaatctaaatcgagaaaatt 211  Q
    | || ||| |  ||||  |||||||||| |||||||  ||| ||||| ||||||| ||  || | ||||| ||||| ||||||||||| |||||||||||    
T  26741778 tcttacggaacccggtgattagtttgaaaaaggtggatcggctgccctgcaaagatcgttccacagttttacacatcttaaaatctaagtcgagaaaatt 26741679  T
Q  212 acaaggttcggatcgtcttaaaaaggcggttagggcggtttcttcgagagtttcagatgggagttcctcgtcggggtcggttaacaatgattgggttaat 311  Q
    |||||| |||||||||||||| ||||| || |||| |||||||||| ||| ||| ||||| ||||| || ||||| || |||||||| ||||||||||||    
T  26741678 acaaggatcggatcgtcttaagaaggctgtaagggtggtttcttcgggagcttcggatggtagttcttcctcgggttcagttaacaacgattgggttaat 26741579  T
Q  312 tgggtggcagtgcatgggaatgagaaggttgtaattgatgatgt 355  Q
    ||||||| ||||||||||||||||||||||||  ||||||||||    
T  26741578 tgggtggaagtgcatgggaatgagaaggttgtggttgatgatgt 26741535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University