View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1371_low_90 (Length: 256)

Name: NF1371_low_90
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1371_low_90
NF1371_low_90
[»] chr6 (2 HSPs)
chr6 (145-232)||(33570611-33570698)
chr6 (42-122)||(33570723-33570803)


Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 145 - 232
Target Start/End: Complemental strand, 33570698 - 33570611
Alignment:
Q  145 ctgtgtttggctgtacaaaatacaaagttcatgttttcagcccctcaaaacagatcaaaagatgaaaaaatgaagattactatttgct 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33570698 ctgtgtttggctgtacaaaatacaaagttcatgttttcagcccctcaaaacagatcaaaagatgaaaaaatgaagattactatttgct 33570611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 42 - 122
Target Start/End: Complemental strand, 33570803 - 33570723
Alignment:
Q  42 caagcaaatgcagtgctatacttataacaaattgaacaaatgtcggtgtaccttgaaaactaaatatcctagtcatgaacc 122  Q
    |||||| || ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33570803 caagcagattcagtgctatacttattacaaattgaacaaatgtcggtgtaccttgaaaactaaatatcctagtcatgaacc 33570723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University