View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13718_low_13 (Length: 204)

Name: NF13718_low_13
Description: NF13718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13718_low_13
NF13718_low_13
[»] chr1 (1 HSPs)
chr1 (13-169)||(48537142-48537298)


Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 169
Target Start/End: Original strand, 48537142 - 48537298
Alignment:
Q  13 ccttttctgagaattatatgtggtggctccaaataacgcataccaatcaaggacatagtacgatcaaaatgatacacttcaggaacatgatcaggactca 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  48537142 ccttttctgagaattatatgtggtggctccaaataacgcataccaatcaaagacatagtacgatcaaaatgatacacttcaggaacatgatcaggactca 48537241  T
Q  113 atttaccctcttctttcaatgccaatgactcaaaataggctctttctttcgtcattg 169  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48537242 atttaccctcttctttcaatgccaatgactcaaaataggctctttctttcgtcattg 48537298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University