View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13714_low_20 (Length: 215)

Name: NF13714_low_20
Description: NF13714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13714_low_20
NF13714_low_20
[»] chr6 (1 HSPs)
chr6 (16-199)||(24884000-24884183)
[»] chr1 (1 HSPs)
chr1 (53-110)||(34593372-34593429)


Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 24884000 - 24884183
Alignment:
Q  16 aatatccaatgcttttaatactgataaccttttggttttgcagacaaattaggaattcaagggaagaaggtgaaaagtaatgatgatttggaggtgattt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24884000 aatatccaatgcttttaatactgataaccttttggttttgcagacaaattaggaattcaagggaagaaggtgaaaagtaatgatgatttggaggtgattt 24884099  T
Q  116 cctttcccctttttgttttctttggtcagtgcctctttttcaattaaaccagggatgagtctctcaggatattctcataatact 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  24884100 cctttcccctttttgttttctttggtcagtgcctctttttcaattaaaccagggatgagtctctcaggatattctgataatact 24884183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 34593429 - 34593372
Alignment:
Q  53 ttgcagacaaattaggaattcaagggaagaaggtgaaaagtaatgatgatttggaggt 110  Q
    ||||||||||| ||||| ||||||| ||||| |||||||||| | |||||||||||||    
T  34593429 ttgcagacaaactaggagttcaaggaaagaaagtgaaaagtactaatgatttggaggt 34593372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University