View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13714_low_19 (Length: 216)

Name: NF13714_low_19
Description: NF13714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13714_low_19
NF13714_low_19
[»] chr7 (2 HSPs)
chr7 (57-202)||(38933478-38933623)
chr7 (1-45)||(38933765-38933809)


Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 57 - 202
Target Start/End: Complemental strand, 38933623 - 38933478
Alignment:
Q  57 tagtgattctatatgcaagaatgactttcgtaacaacccagcaacaaatttttaactaatcttgatcaaattataagaacgttgttggtttaatagcaat 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  38933623 tagtgattctatatgcaagaatgactttcgtaacaacccagcaacaaatttttaactaatcttcatcaaattataagaacgttgttggtttaatagcaat 38933524  T
Q  157 attacatagatacaaaagtcacttcaaatatgaattgagaaagaaa 202  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||    
T  38933523 attacatagatacaaaagtcacttcaaatattaattgagaaagaaa 38933478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 38933809 - 38933765
Alignment:
Q  1 ttcggtagcatgatgaaatgcaaattttatagttattaaagcttg 45  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  38933809 ttcggtagcatgatgaaatgcaaattttatagttattaaagcttg 38933765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University