View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1371-INSERTION-3 (Length: 109)

Name: NF1371-INSERTION-3
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1371-INSERTION-3
NF1371-INSERTION-3
[»] scaffold0155 (1 HSPs)
scaffold0155 (6-109)||(25798-25901)


Alignment Details
Target: scaffold0155 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: scaffold0155
Description:

Target: scaffold0155; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 6 - 109
Target Start/End: Complemental strand, 25901 - 25798
Alignment:
Q  6 cagacatggcttcacaaataggttttgttatgcaacacattgatgattgtattgatagtctgcataaaaatgatatatgcccaatactcgcaaaagatgt 105  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||| ||||| |||||    
T  25901 cagacatggcttcacaaataggttttgttatgcaacacattgatgattgtattgatagtctgcataaaaatgatactagcccaatacttgcaaaggatgt 25802  T
Q  106 tgat 109  Q
    ||||    
T  25801 tgat 25798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University