View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1370_low_85 (Length: 243)

Name: NF1370_low_85
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1370_low_85
NF1370_low_85
[»] chr1 (1 HSPs)
chr1 (83-225)||(37502561-37502699)


Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 83 - 225
Target Start/End: Complemental strand, 37502699 - 37502561
Alignment:
Q  83 gataattctctggtaataatnnnnnnngaatcgtgggtagtttagctagataaaaacattcacaaaagtaatttttaataacaaaacatgtttattccac 182  Q
    |||||||||| |||||||||       ||||||||||||    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  37502699 gataattctccggtaataataaaaaaagaatcgtgggta----agctagataaaaacattcataaaagtaatttttaataacaaaacatgtttattccac 37502604  T
Q  183 ttacaaatttacttatgtaggtaattttgattgagtagtcttc 225  Q
    ||||||||||||| |||||||||||||||||||||||||||||    
T  37502603 ttacaaatttactcatgtaggtaattttgattgagtagtcttc 37502561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University