View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1370_low_59 (Length: 332)

Name: NF1370_low_59
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1370_low_59
NF1370_low_59
[»] chr6 (1 HSPs)
chr6 (1-235)||(28138791-28139025)


Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 28139025 - 28138791
Alignment:
Q  1 tctttttatgtatggatgcatcaacggttgacttttatatttagggagcttctatcagttattgacacctttgggaacaaaaacagggttaaacctgtga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28139025 tctttttatgtatggatgcatcaacggttgacttttatatttagggagcttctatcagttattgacacctttgggaacaaaaacagggttaaacctgtga 28138926  T
Q  101 gggttggatctatgttagactctgtcttaaaggaacctactacaagggaagaaagggcctctcagttcaagtcaccaaacacagactcactcttgttgtc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28138925 gggttggatctatgttagactctgtcttaaaggaacctactacaagggaagaaagggcctctcagttcaagtcaccaaacacagactcactcttgttgtc 28138826  T
Q  201 cttggattcggggaggcgtttatctccacccttgg 235  Q
    |||||||||||||||||||||||||||||||||||    
T  28138825 cttggattcggggaggcgtttatctccacccttgg 28138791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University