View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1370_high_78 (Length: 225)

Name: NF1370_high_78
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1370_high_78
NF1370_high_78
[»] chr2 (1 HSPs)
chr2 (12-145)||(4122697-4122830)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 12 - 145
Target Start/End: Complemental strand, 4122830 - 4122697
Alignment:
Q  12 ttgaggactctccgaatcatccatattgttgctctttttaattatatcagaatgtaccattttttatgacaaaataggctgctgccgataaagcatttgt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4122830 ttgaggactctccgaatcatccatattgttgctctttttaattatatcagaatgtaccattttttatgacaaaataggctgctgccgataaagcatttgt 4122731  T
Q  112 tgaaccagagaaatggatcaagatgagtattctc 145  Q
    |||||||||||| |||||||||||||||||||||    
T  4122730 tgaaccagagaagtggatcaagatgagtattctc 4122697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University