View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13706_low_38 (Length: 243)

Name: NF13706_low_38
Description: NF13706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13706_low_38
NF13706_low_38
[»] chr1 (1 HSPs)
chr1 (1-123)||(24421842-24421964)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 24421964 - 24421842
Alignment:
Q  1 atctttcataaatcattgatttgatacccttttatatagcacactttcatatccatgttgcacactaggtttgtgcaaccatcaaatattgcattgcacc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  24421964 atctttcataaatcattgatttgatacccttttatatagcacactttcatatccatgttgcacactaggtttgtgcaaccatcaaatattgcgttgcacc 24421865  T
Q  101 atcaagctaataaggtaaacaca 123  Q
    |||||||||||||||||||||||    
T  24421864 atcaagctaataaggtaaacaca 24421842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University