View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13703_high_4 (Length: 353)

Name: NF13703_high_4
Description: NF13703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13703_high_4
NF13703_high_4
[»] chr2 (1 HSPs)
chr2 (3-223)||(38883241-38883461)


Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 3 - 223
Target Start/End: Original strand, 38883241 - 38883461
Alignment:
Q  3 gttaatttctgctcagttttgtgttttatgatgttctgattttgcttcattgtagggttgacatgttattcttattatccatgttggtgttctgcaacag 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38883241 gttaatttctgctcagttttgtgttttatgatgttctgattttgcttcattgtagggttgacatgttattcttattatccatgttggtgttctgcaacag 38883340  T
Q  103 cattatgtcctttgtggcaacatcatcagtttgcacactctccatccccctaaaggttttcagttggaaatctatgctagcattgtggtcattgtctttc 202  Q
    ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38883341 cattacgtcctttgtggcaacatcatcagtttgcatactctccatccccctaaaggttttcagttggaaatctatgctagcattgtggtcattgtctttc 38883440  T
Q  203 tacctgttaagttgcttcttg 223  Q
    |||||||||||||||||||||    
T  38883441 tacctgttaagttgcttcttg 38883461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University