View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13700_low_4 (Length: 274)

Name: NF13700_low_4
Description: NF13700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13700_low_4
NF13700_low_4
[»] chr3 (2 HSPs)
chr3 (170-264)||(31423694-31423788)
chr3 (50-104)||(31423574-31423628)


Alignment Details
Target: chr3 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 170 - 264
Target Start/End: Original strand, 31423694 - 31423788
Alignment:
Q  170 agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtgtggctggtgatgatgtgatgtctcgttggtgatgatgt 264  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  31423694 agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtatggctggtgatgatgtgatgtctcgttggtgatgatgt 31423788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 50 - 104
Target Start/End: Original strand, 31423574 - 31423628
Alignment:
Q  50 cacggttgttttgttgttcacagattttgaggtggttgctgagtttgaatgttga 104  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
T  31423574 cacggttgtgttgttgttcacggattttgaggtggttgctgagtttgaatgttga 31423628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University