View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1370-INSERTION-4 (Length: 161)

Name: NF1370-INSERTION-4
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1370-INSERTION-4
NF1370-INSERTION-4
[»] chr3 (1 HSPs)
chr3 (46-161)||(52765295-52765410)


Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 46 - 161
Target Start/End: Complemental strand, 52765410 - 52765295
Alignment:
Q  46 ctaatgatacacaattcatagattgcttgttttagtgcatatggaagaatcagaaactctaccgaaaatttccctacatttgtaattactggcgcattgc 145  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52765410 ctaatgatacacaattcatagattgcttgttttagtgcatatggaagaatcagaaactctaccgaaaatttccctacatttgtaattactggcgcattgc 52765311  T
Q  146 atgtgctacgtaacct 161  Q
    ||||||||||||||||    
T  52765310 atgtgctacgtaacct 52765295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University