View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1369_high_30 (Length: 408)

Name: NF1369_high_30
Description: NF1369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1369_high_30
NF1369_high_30
[»] chr7 (1 HSPs)
chr7 (30-144)||(450831-450945)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 2e-53; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 30 - 144
Target Start/End: Complemental strand, 450945 - 450831
Alignment:
Q  30 atatgcacatacatttttatcaaataagttcccccctcaaaacaaaatgcatcggatgcacaatgtaaatcaaagctgggagcacacttactcatagagc 129  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  450945 atatgaacatacatttttatcaaataagttcccccctcaaaacaaaatgcatcggatgcacaatgtaaatcaaagatgggagcacacttactcatagagc 450846  T
Q  130 ttctgaaaatttaga 144  Q
    |||||||||||||||    
T  450845 ttctgaaaatttaga 450831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University