View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13691_low_9 (Length: 244)

Name: NF13691_low_9
Description: NF13691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13691_low_9
NF13691_low_9
[»] chr4 (3 HSPs)
chr4 (21-244)||(23817232-23817455)
chr4 (135-197)||(23826752-23826812)
chr4 (60-98)||(23830928-23830966)


Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 21 - 244
Target Start/End: Complemental strand, 23817455 - 23817232
Alignment:
Q  21 cccaggctcccccagtgacccaacagtaaagacatatgggaaaggtgaatgggacgaaggaaggtgagtatggtgattatttgttgtaacataacatcac 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23817455 cccaggctcccccagtgacccaacagtaaagacatatgggaaaggtgaatgggacgaaggaaggtgagtatggtgattatttgttgtaacataacatcac 23817356  T
Q  121 attcatttatgacttgttatgggaatagaagcatggtgtaactgtaatggaccccgttttgtttgttttgtttggaattgaatcttgccattctgcagct 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23817355 attcatttatgacttgttatgggaatagaagcatggtgtaactgtaatggaccccgttttgtttgttttgtttggaattgaatcttgccattctgcagct 23817256  T
Q  221 gcaaagtggaatggaaaccccttt 244  Q
    ||||||||||||||||||||||||    
T  23817255 gcaaagtggaatggaaaccccttt 23817232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 135 - 197
Target Start/End: Complemental strand, 23826812 - 23826752
Alignment:
Q  135 tgttatgggaatagaagcatggtgtaactgtaatggaccccgttttgtttgttttgtttggaa 197  Q
    ||||||||||| ||||||||||||||||||||| |||||||  ||| ||||||||||||||||    
T  23826812 tgttatgggaacagaagcatggtgtaactgtaagggacccc--tttttttgttttgtttggaa 23826752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 98
Target Start/End: Complemental strand, 23830966 - 23830928
Alignment:
Q  60 gaaaggtgaatgggacgaaggaaggtgagtatggtgatt 98  Q
    ||||||| || ||||||||||||||||||||||||||||    
T  23830966 gaaaggtaaaggggacgaaggaaggtgagtatggtgatt 23830928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University