View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13686_low_24 (Length: 237)

Name: NF13686_low_24
Description: NF13686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13686_low_24
NF13686_low_24
[»] chr2 (1 HSPs)
chr2 (1-215)||(19316051-19316266)


Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 19316051 - 19316266
Alignment:
Q  1 tgaatggttttgattggtagaaactcagcatgagtaactctacccactttttggtgctgggtattattgttgctaccattccactcacccaaatcacaaa 100  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||    
T  19316051 tgaatggttttgattggtagaaactcagcatgagaaactctacccactttttggtgccgggtattattgttgccacctttccactcacccaaatcacaaa 19316150  T
Q  101 attttctgtnnnnnnnntgtatatacga-agtggtcgtgcgttcaccttcgtggttgtaccaccctctactcttctaagagggtcttttagtcaacggca 199  Q
    |||||||||        |||||||||||  |||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||    
T  19316151 attttctgtaaaaaaaatgtatatacgatggtggtcgtgcgttcaccttcgtggttgtaccaccctctactcctctgacagggtcttttagtcaacggca 19316250  T
Q  200 tcacgtctccacgacc 215  Q
    || |||||||||||||    
T  19316251 tcgcgtctccacgacc 19316266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University