View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1368-INSERTION-1 (Length: 104)

Name: NF1368-INSERTION-1
Description: NF1368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1368-INSERTION-1
NF1368-INSERTION-1
[»] chr1 (1 HSPs)
chr1 (9-104)||(29518911-29519006)
[»] chr7 (1 HSPs)
chr7 (9-53)||(40101068-40101112)


Alignment Details
Target: chr1 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 9 - 104
Target Start/End: Original strand, 29518911 - 29519006
Alignment:
Q  9 aacatacattaagatgttgagaggaagatcgagagcgaggaagttttcaacaaacgatctaacagacttcactgaacaaaggtcgagcttcattat 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29518911 aacatacattaagatgttgagaggaagatcgagagcgaggaagttttcaacaaacgatctaacagacttcactgaacaaaggtcgagcttcattat 29519006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 40101112 - 40101068
Alignment:
Q  9 aacatacattaagatgttgagaggaagatcgagagcgaggaagtt 53  Q
    |||| ||||||||||||||||||||||||| ||||| | ||||||    
T  40101112 aacaaacattaagatgttgagaggaagatcaagagcaatgaagtt 40101068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University