View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13677_high_1 (Length: 429)

Name: NF13677_high_1
Description: NF13677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13677_high_1
NF13677_high_1
[»] chr5 (1 HSPs)
chr5 (4-209)||(34901252-34901456)
[»] chr4 (1 HSPs)
chr4 (334-409)||(30091513-30091588)


Alignment Details
Target: chr5 (Bit Score: 170; Significance: 4e-91; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 4 - 209
Target Start/End: Complemental strand, 34901456 - 34901252
Alignment:
Q  4 gcaactcgtcatattcctactaatgtgtgtaaccagcttgacaaaatagctagaagcttttctttggggcggtgacgaggtatcaaggacttgaaaccat 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||    
T  34901456 gcaactcgtcatattcctactaatgtgtgtaaccagcttgacaaaatagctagaagcttt-ctttggggcggtgacggggtatcaaggacttgaaaccat 34901358  T
Q  104 gttaattggcatacagttactaccttgaaacactttgagggccttggtatttgtgaagctagggtcctaaatgtgtctctttttggaaaacttgtgtgga 203  Q
    |||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||    
T  34901357 gttaattggcatacagttactaccttgaaacactctgtgggccttggtatttgtgaagttaggatcataaatgtgtctctttttggaaaacttgtgtgga 34901258  T
Q  204 atatgt 209  Q
     |||||    
T  34901257 gtatgt 34901252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 334 - 409
Target Start/End: Complemental strand, 30091588 - 30091513
Alignment:
Q  334 ttcttttgcccatgggcataagttgcgtataggtgccggtgaaacttcattttggtatgagtattggaccaaacta 409  Q
    ||||||||| | |||  ||||| ||| |||||| || ||||||||||  |||||||||||||||||||||||||||    
T  30091588 ttcttttgctcctggttataaggtgcatataggggctggtgaaactttcttttggtatgagtattggaccaaacta 30091513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University