View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13672_high_32 (Length: 238)

Name: NF13672_high_32
Description: NF13672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13672_high_32
NF13672_high_32
[»] chr2 (1 HSPs)
chr2 (1-226)||(1179172-1179403)


Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 1179403 - 1179172
Alignment:
Q  1 gttttgtctccacaacattctgattcaggtatatcttttccaccggagggatattccgaggcggaggctcctgctccggcaccggtgggtctggaagcgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1179403 gttttgtctccacaacattctgattcaggtatatcttttccaccggagggatattccgaggcggaggctcctgctccggcaccggtgggtctggaagcgg 1179304  T
Q  101 tggtgcagaagaagaa------tagaagagtttcgttgatggaaatgtccgagaaatcagaagcgttggatggagtgagaaagtgtgaaagtgtagccgt 194  Q
    ||||||||||||||||      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1179303 tggtgcagaagaagaagaagaatagaagagtttcgttgatggaaatgtccgagaaatcagaagcgttggatggagtgagaaagtgtgaaagtgtagccgt 1179204  T
Q  195 tggattgaaagagcacataagtgatattgatg 226  Q
    ||||||||||||||||||||||||||||||||    
T  1179203 tggattgaaagagcacataagtgatattgatg 1179172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University