View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13667_high_10 (Length: 344)

Name: NF13667_high_10
Description: NF13667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13667_high_10
NF13667_high_10
[»] scaffold0024 (1 HSPs)
scaffold0024 (7-335)||(5674-6002)


Alignment Details
Target: scaffold0024 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 7 - 335
Target Start/End: Complemental strand, 6002 - 5674
Alignment:
Q  7 taactcaagggattggagattttgatgagttattgtggttttcggtttcaattgcaggaaaggttaataatggtaatggaaatggtagtttgtgggaggc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6002 taactcaagggattggagattttgatgagttattgtggttttcggtttcaattgcaggaaaggttaataatggtaatggaaatggtagtttgtgggaggc 5903  T
Q  107 ttcagatgagggacaaggtggaggagtttctgctaaattaggaagttcatttaggaaagatgtaggttttttgagtgataattcggatgttgatgttaag 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5902 ttcagatgagggacaaggtggaggagtttctgctaaattaggaagttcatttaggaaagatgtaggttttttgagtgataattcggatgttgatgttaag 5803  T
Q  207 tccaatgctggtttctcgagggaggatcaaagggattcaggaaggttgaataaggaacgacgtgagaggattctgaatcgttacgaggatggtagggaga 306  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5802 tccaatgctggtttctcgagggaagatcaaagggattcaggaaggttgaataaggaacgacgtgagaggattctgaatcgttacgaggatggtagggaga 5703  T
Q  307 aaggagtttcggggaacggtgatgatgtc 335  Q
    |||||||| ||||||||||| ||||||||    
T  5702 aaggagttccggggaacggttatgatgtc 5674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University