View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13664_high_6 (Length: 220)

Name: NF13664_high_6
Description: NF13664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13664_high_6
NF13664_high_6
[»] chr2 (1 HSPs)
chr2 (18-131)||(35401609-35401722)
[»] chr8 (1 HSPs)
chr8 (18-68)||(35848575-35848625)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 35401609 - 35401722
Alignment:
Q  18 atgaatgtgagaggacttagaattgcacatgtgaagagtcatttgcaggtaatatagctatgcatgtatagaagttgatttatgcacaacactagtgtta 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  35401609 atgaatgtgagaggacttagaattgcacatgtgaagagtcatttgcaggtaatatagctatgcatgtatagaagttgatttatggacaacactagtgtta 35401708  T
Q  118 cttaatttagagta 131  Q
    ||||||||||||||    
T  35401709 cttaatttagagta 35401722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 35848575 - 35848625
Alignment:
Q  18 atgaatgtgagaggacttagaattgcacatgtgaagagtcatttgcaggta 68  Q
    ||||||||||||||||| || ||||| ||||| ||||||||||||||||||    
T  35848575 atgaatgtgagaggactcagcattgctcatgtcaagagtcatttgcaggta 35848625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University