View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1365_low_44 (Length: 203)

Name: NF1365_low_44
Description: NF1365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1365_low_44
NF1365_low_44
[»] chr6 (1 HSPs)
chr6 (84-203)||(3712359-3712477)


Alignment Details
Target: chr6 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 84 - 203
Target Start/End: Complemental strand, 3712477 - 3712359
Alignment:
Q  84 atccaggaaatgaaaattgctagttatgccagcaaaataaaaacatataaatattttattggcaaaattgcnnnnnnnnnnaaaaaccaaaatgagtaat 183  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||            |||||||||||||||||    
T  3712477 atccaggaaatgaaaattgctagccatgccagcaaaataaaaacatataaatattttattggcaaaattgcattttttttt-taaaccaaaatgagtaat 3712379  T
Q  184 agtcaattttgtttctgaat 203  Q
    ||||||||||||||||||||    
T  3712378 agtcaattttgtttctgaat 3712359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University