View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13655_low_1 (Length: 251)

Name: NF13655_low_1
Description: NF13655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13655_low_1
NF13655_low_1
[»] chr7 (1 HSPs)
chr7 (18-238)||(36734178-36734398)


Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 36734178 - 36734398
Alignment:
Q  18 acatcttacggggaagtttaatatttctgattttatttggttttttaagaactgggatgtccaggggtttagcaaagggttaaaggaaattagggacagg 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  36734178 acatcttacggggaagtttaatatttctgattttatttggttttttaagaactgggatgtccaggggtttagcaaagggttagaggaaattagggacagg 36734277  T
Q  118 tttgattctatgatggagaggattatcaaggagcatcaagaagtaaggaggaggagaaaggaagttggtggaggagaaggtcaaattaaggatctacttg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  36734278 tttgattctatgatggagaggattatcaaggagcatcaagaagtaaggaggaggagaaaagaagttggtggaggagaaggtcaaattaaggatctacttg 36734377  T
Q  218 atattttattggatattcttg 238  Q
    |||||||||||||||||||||    
T  36734378 atattttattggatattcttg 36734398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University