View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1364_low_80 (Length: 245)

Name: NF1364_low_80
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1364_low_80
NF1364_low_80
[»] chr2 (2 HSPs)
chr2 (86-224)||(18504865-18505007)
chr2 (3-44)||(18504786-18504827)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 86 - 224
Target Start/End: Original strand, 18504865 - 18505007
Alignment:
Q  86 gtaattaaacatgtcaagtgagatggaggaagaaattgtttgtttgggagggagaacttagtcgtgaagttggttggggttcatcttcatatcgagggtc 185  Q
    ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| | ||||||||||  |||| ||||||||    
T  18504865 gtaattaaacatgtcaagtgagatggaggaagagattggttgtttgggagggagaacttagtcgtgaagttgttaggggttcatccccataccgagggtc 18504964  T
Q  186 ----tttctggtattgaaagtaaagctcagatggagtgttcat 224  Q
        |||||||||||||||||||||||||||||||||||||||    
T  18504965 ttgatttctggtattgaaagtaaagctcagatggagtgttcat 18505007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 18504786 - 18504827
Alignment:
Q  3 aataaaagaacgatagatacctttttaatgttaataataata 44  Q
    |||||||||| |||||||||||||||||||||||||||||||    
T  18504786 aataaaagaaggatagatacctttttaatgttaataataata 18504827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University