View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1364_low_59 (Length: 264)

Name: NF1364_low_59
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1364_low_59
NF1364_low_59
[»] chr1 (2 HSPs)
chr1 (1-125)||(15855264-15855391)
chr1 (205-255)||(15855458-15855508)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 15855264 - 15855391
Alignment:
Q  1 tgtttgcaatgtgaaatttatactgagatagaatcaatatactaactcgaatggttgaagtaatttagattctggtacttac---tcatgatattaatta 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||    
T  15855264 tgtttgcaatgtgaaatttatactgagatagaatcaatatactaactcgaatggttgaagtaatttagattctggtacttactcatcatgatattaatta 15855363  T
Q  98 cgaacaattagtgtcttttggtcttaac 125  Q
    ||||||||||||||||||||||| ||||    
T  15855364 cgaacaattagtgtcttttggtcataac 15855391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 205 - 255
Target Start/End: Original strand, 15855458 - 15855508
Alignment:
Q  205 tagtcaaatattgttatagtttggatcaaacttggataccccgagtataat 255  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15855458 tagtcaaatattgttatagtttggatcaaacttggataccccgagtataat 15855508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University