View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13649_high_10 (Length: 249)

Name: NF13649_high_10
Description: NF13649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13649_high_10
NF13649_high_10
[»] chr8 (1 HSPs)
chr8 (14-241)||(33343672-33343891)


Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 14 - 241
Target Start/End: Complemental strand, 33343891 - 33343672
Alignment:
Q  14 aaatggggttctgcgggacactgaaataagatctaacttattctcagttactataaaatatagagaattcagtttatttggactgaatttctagacgaga 113  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33343891 aaatggggttctgcgggatactgaaataagatctaacttattctcagttactataaaatatagagaattcagtttatttggactgaatttctagacgaga 33343792  T
Q  114 tagaggtataacatcatgttgactacagtattgtcgcattatcgtattaaatatccctacttttgcgatacaatacaaataccaatgaaatgtaccattg 213  Q
    |||| ||| |||| ||||||||||||| |||||| ||        ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  33343791 tagaagtagaacaacatgttgactacactattgttgc--------atttaatatccctacttttacgatacaatacaaataccaatgaaatgtaccattg 33343700  T
Q  214 attggcatgtgaggctcacatgccgttt 241  Q
    |||||||||||| |||||||||||||||    
T  33343699 attggcatgtgaagctcacatgccgttt 33343672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University