View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1363_low_6 (Length: 363)

Name: NF1363_low_6
Description: NF1363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1363_low_6
NF1363_low_6
[»] chr8 (1 HSPs)
chr8 (78-215)||(28974818-28974954)


Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 78 - 215
Target Start/End: Original strand, 28974818 - 28974954
Alignment:
Q  78 tacagttaacaacaaaagacctttgaaaagaaacagtgatataaaaataaaatacctttgattatattctctatagttttggacacaaatttatataaga 177  Q
    ||||||||||||||||||||||||||||||||||| | ||||||  ||||||||||||||| | ||| ||||||||||||| ||||||||||||||||||    
T  28974818 tacagttaacaacaaaagacctttgaaaagaaacaataatataatgataaaatacctttgagtgtat-ctctatagttttgtacacaaatttatataaga 28974916  T
Q  178 cgttgcaaaggaaaattggtgtgaaatcacctttgatt 215  Q
    ||||||||||||||||||||||||||||||||||||||    
T  28974917 cgttgcaaaggaaaattggtgtgaaatcacctttgatt 28974954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University