View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13639_high_8 (Length: 234)

Name: NF13639_high_8
Description: NF13639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13639_high_8
NF13639_high_8
[»] chr6 (1 HSPs)
chr6 (62-215)||(34883324-34883476)


Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 62 - 215
Target Start/End: Original strand, 34883324 - 34883476
Alignment:
Q  62 ctactgttaccttgttttactacctacaaaatctagtctagtctatctaggaacatagtaatacttgtcaccgttggattttccttagacaaggatcatt 161  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  34883324 ctactgttaccttgttttgctacctacaaaatctagtctagtctatctaggaacatagtaatact-gtcaccgttggattttccttagacaaggatcatt 34883422  T
Q  162 catgactgagtttgtgatttacatgcatattacgtggcttcttatcctctttcc 215  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  34883423 catgagtgagtttgtgatttacatgcatattacgtggcttcttatcctctttcc 34883476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University