View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13636_low_15 (Length: 298)

Name: NF13636_low_15
Description: NF13636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13636_low_15
NF13636_low_15
[»] chr6 (2 HSPs)
chr6 (18-160)||(31465332-31465474)
chr6 (225-289)||(31465539-31465603)


Alignment Details
Target: chr6 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 31465332 - 31465474
Alignment:
Q  18 agagcccggtaagcttttgcaccaatgccatgaaatctttaggctgagtatgaataacacgtggagaatgtgtgtagattataaccgggctacgatgttg 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  31465332 agagcccggtaagcttttgcaccaatgccatgaaatctttaggctgagtatgtataacacgtggagaatgtgtgtagattataaccgggctacgatgttg 31465431  T
Q  118 ttggggtggtttatttgatgccaccatggtattcatcattgca 160  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  31465432 ttggggtggtttatttgatgccaccatggtattcatcattgca 31465474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 225 - 289
Target Start/End: Original strand, 31465539 - 31465603
Alignment:
Q  225 aatgagaatctttattgattttcaaatgtggtggtaacaatccattaacgttggtgttagatttt 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31465539 aatgagaatctttattgattttcaaatgtggtggtaacaatccattaacgttggtgttagatttt 31465603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University