View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13636_high_20 (Length: 215)

Name: NF13636_high_20
Description: NF13636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13636_high_20
NF13636_high_20
[»] chr5 (2 HSPs)
chr5 (82-197)||(4119639-4119754)
chr5 (15-83)||(4119340-4119408)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 82 - 197
Target Start/End: Original strand, 4119639 - 4119754
Alignment:
Q  82 aataaaacttcatata--ttttttattgaattaattcttatcaagagatatatatgaaacatcacaggcgaacgaggaaaaggcgtttgacgattcatga 179  Q
    ||||||||||||||||  ||||||||||||||| |||||||||||||||||  ||||||||||||||||||||||||||||||| |||||||||||||||    
T  4119639 aataaaacttcatatacattttttattgaattagttcttatcaagagatat--atgaaacatcacaggcgaacgaggaaaaggcatttgacgattcatga 4119736  T
Q  180 caactctgtcgtgacatt 197  Q
    ||||||||||||||||||    
T  4119737 caactctgtcgtgacatt 4119754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 15 - 83
Target Start/End: Original strand, 4119340 - 4119408
Alignment:
Q  15 gatgaactttgtggtgacgtttcatgagatatgatgaattgggaacatactgatcatcatagtctagaa 83  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||    
T  4119340 gatgaactttgtggtgacgtttcaggagatatgatgaattgggaacatgctgatcatcatagtctagaa 4119408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University