View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13633_high_13 (Length: 201)

Name: NF13633_high_13
Description: NF13633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13633_high_13
NF13633_high_13
[»] chr2 (1 HSPs)
chr2 (20-183)||(41263849-41264012)


Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 183
Target Start/End: Original strand, 41263849 - 41264012
Alignment:
Q  20 atcaatgaacagtattagcatcacaattacagatgaaagtgtcgaaaatatgcatatggaagatcactttgagtgaagatattttgattaccgtgtaata 119  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41263849 atcaatgaacagtattagcatcacaattatagatgaaagtgtcgaaaatatgcatatggaagatcactttgagtgaagatattttgattaccgtgtaata 41263948  T
Q  120 acccctttcgatcgaggcaacagaatttcagtagataaacaggagaagatgtggtgggtttctg 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41263949 acccctttcgatcgaggcaacagaatttcagtagataaacaggagaagatgtggtgggtttctg 41264012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University