View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13632_low_27 (Length: 218)

Name: NF13632_low_27
Description: NF13632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13632_low_27
NF13632_low_27
[»] chr7 (2 HSPs)
chr7 (16-137)||(4523159-4523280)
chr7 (148-202)||(4522623-4522677)


Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 16 - 137
Target Start/End: Complemental strand, 4523280 - 4523159
Alignment:
Q  16 cataggcgagtaaagcgacttgggttgtgatttagccaaaaattggatcattatatgatccactcaaacttcattgctccgatttcagcttagatggcca 115  Q
    ||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||    
T  4523280 catagacgagtaaagcgacctgggttgtgatttagccaaaaattggatcattatatgatacactcaaacttcattgctcagatttcagcttagatggcca 4523181  T
Q  116 aaaacaaattaaggattaacta 137  Q
    ||||||||| ||||||||||||    
T  4523180 aaaacaaatcaaggattaacta 4523159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 202
Target Start/End: Complemental strand, 4522677 - 4522623
Alignment:
Q  148 tgtccaccagcaacatcatctctaacgactcccttggatcacgccgcatatcatg 202  Q
    ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||    
T  4522677 tgtccactagcaacatcatctctaaccactcccttggatcacgccgcatatcatg 4522623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University